What is the size of your target DNA?

What is the size of your target DNA?

What is the size of your target DNA? 150 150 Nyagu

Primer Design Exercise Currently Monsanto owns the patent on glyphosate, which is commonly known as Roundup®. It is the most popular herbicide used today because it kills a broad spectrum of weeds and is easily broken down into non-toxic compounds. The catch is that Monsanto also owns the patent on the gene that confers resistance to glyphosate, which they have transformed into several crops such as corn and soybean to make them “Round-up Ready”, or resistant to glyphosate. Many researchers are trying to find novel genes that will also confer resistance to glyphosate for both evolutionary and economic reasons. Recently, a Chinese group found a bacterium, Pseudomonas putida strain 4G-1, which is naturally resistant to glyphosate1. They have cloned the novel gene, aroA, that is significantly different in sequence from the previous AroA gene, and are hopeful that it will be another source of glyphosate resistance. The AroA gene encodes the enzyme 3-phosphoshikimate 1-carboxyvinyltransferase, which plays a key role in the biosynthesis of aromatic amino acids. Glyphosate works by disrupting this enzyme and thus the biosynthesis of aromatic amino acids. Resistance is found by mutating the AroA gene such that glyphosate cannot bind to the resulting protein. You have just been hired to select strains of Pseudomonas putida with the new aroA gene to provide a new glyphosate resistant cultivar. Your first challenge will be to create primer pairs (forward and reverse) that will amplify a portion of the aroA gene that contains the underlined region (see sequence below). 1. Given the sequence on the following page, choose forward and reverse primers that will amplify the underlined portion of the aroA gene. a. Underline the primer sequence on the following page. Then write out your primers below and indicate the 5’ and 3’ ends. Remember that the 3’ or reverse primer is the reverse complement of the template (think about which direction DNA extends). b. What is the size of your target DNA? (Note: each line contains 70 nucleotide bases) 1 Sun, Y. et al. 2005. Novel AroA with high tolerance to glyphosate, encoded by a gene of Pseudomonas putida 4G1 isolated from an extremely polluted environment in China. Applied and Environmental Microbiology. 71 (8): 4771-4776 >gi|51587624|emb|AJ812018.1| Pseudomonas putida aroA gene for 3phosphoshikimate 1-carboxyvinyltransferase 5’-GATCATAAAACATGCTTGTATAAAGGATGCTGCCATGTTCCGTGAACTGGAAGCGAACAATCTTGCGGTA TATCAGAAAAAGCCAAAGCTGATTGCAGTGCTTCTTCAGCGTAATGCTCAGTTAAAAGCGAAGGTTGTTC AGGAGGATGAGTTCGAAAAGTCGGTAAGGCGTTTGTTGAACTTTGGTCATACATTGGGGCATGCCATCGA AAATGAATATGCGTTGATGCATGGCCATGCGGTTGCTATAGGAATGACATACGCGTGTCATATTTCTGAG CAATTGTCTGGATTCAAACAAACAAATCGCGTGGTAGAAGTGTTGGAACAATATGGGTTACCGACTTATA TGGCATTCGATAGGGAAAAGGCTTTTAATCTGTTGAAAATGGACAAGAAGCGTGAAAAAAAGGAAATGAA CTATGTGTTGCTGGAAAAAGTAGGGAAGGGAGTGGTGAAGAGTATTCCACTGGTTCAATTAGAAAAAATC ATTCAAGCATTACCAAAGTGAAAGTAACAATACAGCCCGGAGATCTGACTGGAATTATCCAGTCACCCGC TTCAAAAAGTTCGATGCAGCGAGCTTGTGCTGCTGCACTGGTTGCAAAAGGAATAAGTGAGATCATTAAT CCCGGTCATAGCAATGATGATAAAGCTGCCAGGGATATTGTAAGCCGGCTTGGTGCCAGGCTTGAAGATC AGCCTGATGGTTCTTTGCAGATAACAAGTGAAGGCGTAAAACCTGTCGCTCCTTTTATTGACTGCGGTGA ATCTGGTTTAAGTATCCGGATGTTTACTCCGATTGTTGCGTTGAGTAAAGAAGAGGTGACGATCAAAGGA TCTGGAAGCCTTGTTACAAGACCAATGGATTTCTTTGATGAAATTCTTCCGCATCTCGGTGTAAAAGTTA AATCTAACCAGGGTAAATTGCCTCTCGTTATACAGGGGCCATTGAAACCAGCAGACGTTACGGTTGATGG GTCCTTAAGCTCTCAGTTCCTTACAGGTTTGTTGCTTGCATATGCGGCCGCAGATGCAAGCGATGTTGCG ATAAAAGTAACGAATCTCAAAAGCCGTCCGTATATCGATCTTACACTGGATGTGATGAAGCGGTTTGGTT TGAAGACTCCCGAGAATCGAAACTATGAAGAGTTTTATTTCAAAGCCGGGAATGTATATGATGAAACGAA AATGCAACGATACACCGTAGAAGGCGACTGGAGCGGTGGTGCTTTTTTACTGGTAGCGGGGGCTATTGCC GGGCCGATCACGGTAAGAGGTTTGGATATAGCTTCGACGCAGGCTGATAAAGCGATCGTTCAGGCTTTGA TGAGTGCGAACGCAGGTATTGCGATTGATGCAAAAGAGATCAAACTTCATCCTGCTGATCTCAATGCATT TGAATTTGATGCTACTGATTGCCCGGATCTTTTTCCGCCATTGGTTGCTTTGGCGTCTTATTGCAAAGGA GAAACAAAGATCAAAGGCGTAAGCAGGCTGGCGCATAAAGAAAGTGACAGAGGATTGACGCTGCAGGACG AGTTCGGGAAAATGGGTGTTGAAATCCACCTTGAGGGAGATCTGATGCGCGTGATCGGAGGGAAAGGCGT AAAAGGAGCTGAAGTTAGTTCAAGGCACGATCATCGCATTGCGATGGCTTGCGCGGTGGCTGCTTTAAAA GCTGTGGGTGAAACAACCATCGAACATGCAGAAGCGGTGAATAAATCCTACCCGGATTTTTACAGCGATC TTAAACAACTTGGCGGTGTTGTATCTTTAAACCATCAATTTAATTTCTCATGAATAGCTTCGGCCGCATC TTCAGGGTGCATATTTTTGGCGAATCACATGGTGAATCAGTAGGCATCGTTATTGATGGTTGTCCTGCTG GTCTGTCATTGTCCGAAGAAGATC-3’ 2. For each primer you designed, use the website and the guidelines on the instruction sheet to determine whether they meet the basic primer requirements. Record the Tm, length, molecular weight, and possibility of secondary structures or primer dimers and use the statistics to qualify your decision to use or not use the primers for a PCR reaction. 3. To determine the specificity of your primer pair to the aroA sequence, run a nucleotide BLAST by following the directions on the instruction page. a. What does the E-value indicate? What is another way to determine homology between two sequences? b. Write down the organism and E-value score from the two highest matches for each primer sequence. Did you get back the sequence you put in? c. How many nucleotides aligned between your sequences and the first match for each? 4. Now that you have some experience designing primers and an idea about what makes a good primer, check the CamV35S primers used to determine the presence of a transgene in your food products. Sense (forward) primer: 5’GCT CCT ACA AAT GCC ATC A3’ Antisense (reverse) primer: 5’GAT AGT GGG ATT GTG GGT CA3’ a. Provide a short summary about the primer pairs including characteristics such as melting temperature, secondary structures, and specificity using this worksheet as a guide. b. Do you think these primers are a good choice to amplify the 35S promoter from your food product? Consider the specificity of your primer pairs to transgenic ingredients as well as other ingredients that may be in your products. Overview • PCR – In depth • Primer Introduction • Primer Activity Polymerase Chain Reaction • Polymerase chain reaction, or PCR, is a technique to make many copies of a specific DNA region in vitro. • PCR relies on a thermostable DNA polymerase (enzyme), Taq polymerase, and requires DNA primers designed specifically for the DNA region of interest. • In PCR, the reaction is repeatedly cycled through a series of temperature changes, which allow many copies of the target region to be produced. • PCR has many research and practical applications. It is routinely used in DNA cloning, medical diagnostics, and forensic analysis of DNA. https://www.khanacademy.org/science/biology/biotech-dna-technology/dna-sequencing-pcr-electrophoresis/a/polymerase-chain-reaction-pcr What is Polymerase Chain Reaction (PCR)? • Developed by Kary Mullis in 1983. • PCR uses a logarithmic process to amplify DNA sequences. • Typically, the goal of PCR is to make enough of the target DNA region that it can be analyzed or used in some other way. For instance, DNA amplified by PCR may be sent for sequencing, visualized by gel electrophoresis, or clones into a plasmid for further experiments. What Does PCR Do? • A thermostable DNA polymerase is used in repeated cycles of primer annealing, DNA synthesis, and dissociation of duplex DNA to serve as new templates. • To complete a PCR reaction you must have: – Template DNA – dNTPS – Thermostable polymerase – cofactors PCR Primers • Like other DNA polymerases, Taq polymerase can only make DNA if it’s given a primer, a short sequence of nucleotides that provides a starting point for DNA synthesis. • In a PCR reaction, the experimenter determines the region of DNA that will be copied, or amplified, by the primers she or he chooses. • PCR primers are short pieces of single-stranded DNA, usually around 20 nucleotides in length. • Two primers are used in each PCR reaction, and they are designed so that they flank the target region (region that should be copied). – That is, they are given sequences that will make them bind to opposite strands of the template DNA, just at the edges of the region to be copied. The primers bind to the template by complementary base pairing. https://www.khanacademy.org/science/biology/biotech-dna-technology/dna-sequencing-pcr-electrophoresis/a/polymerase-chain-reaction-pcr DNA Polymerase Adds Nucleotides 5’ 🡪 3’ PCR Primers Steps of PCR 1. Denaturation (96 °C): Heat the reaction strongly to separate, or denature, the DNA strands. This provides single-stranded template for the next step. 2. Annealing (55 – 65°C): Cool the reaction so the primers can bind to their complementary sequences on the single-stranded template DNA. 3. Extension (72 °C): Raise the reaction temperatures so Taq polymerase extends the primers, synthesizing new strands of DNA. Overview of How PCR Amplifies DNA Original Intermediate Target How Does PCR Amplify DNA? PCR Products Intro to Primer Design • Bind to DNA strand and act as template for replication. • Usually 17-24 nucleotides in length and specific to target DNA – Forward and Reverse primers shouldn’t differ by more than 3 bp in length – Should have Tm within 5 °C – Tm may be calculated approximately with 2(A+T)+4(G+C) • Base composition should have 40-60% GC content • 3’ ends of primers should not be complementary to any other part of primer • Good online tools available for primer design PCR setup considerations • https://www.thermofisher.com/us/en/home/ life-science/cloning/cloning-learningcenter/invitrogen-school-of-molecularbiology/pcr-education/pcr-reagentsenzymes/pcr-componentconsiderations.html#dNTPs Directionality of Primers https://www.youtube.com/watch?v=c-f1H07D_70 Primer Design Activity Primer Design Tool – ApE • Copy and Paste FASTA sequence Primer Design – Find Area of Interest Primer Design – Select Region of Interest and Some Extra Primer Design – Find Forward Primer Forward Primers Forward Primer – Create Feature Reverse Primer • Go back to selected region • Find primer Reverse Primer Reverse Primer Activities • Primer Design Activity – Complete the primer design activity in-class today, or submit at the beginning of class on Thursday. • GMO Investigation – Read entire student manual (including protocol) – Read Extra Info – Answer questions on p. 36 of the student manual BEFORE coming to class on Thursday. **I may collect your answers.** QUESTIONS? • Review of PCR • Introduction to GMO Lab • Don’t forget the assignments you have due!!
Purchase answer to see full attachment